Commande rapide

Humain S100A11 / S100C expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Humain S100A11 Informations sur les produits clonés de cDNA
    Taille du ADNc:318bp
    Description du ADNc:Full length Clone DNA of Homo sapiens S100 calcium binding protein A11 with C terminal HA tag.
    Synonyme du gène:MLN70, S100C, S100A11
    Site de restriction:
    Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Description de la séquence:
    ( We provide with S100A11 qPCR primers for gene expression analysis, HP101050 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Humain S100A11 / S100C expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur on other vectors
    Humain S100A11 / S100C expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG11140-ACGCHF270
    Humain S100A11 / S100C expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG11140-ACRCHF270
    Humain S100A11 / S100C expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG11140-ANGCHF270
    Humain S100A11 / S100C expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG11140-ANRCHF270
    Humain S100A11 / S100C expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11140-CFCHF230
    Humain S100A11 / S100C expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG11140-CHCHF230
    Humain S100A11 / S100C expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG11140-CMCHF230
    Humain S100A11 / S100C expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG11140-CYCHF230
    Humain S100A11 / S100C Gène ADNc clone le vecteur de clonageHG11140-MCHF90
    Humain S100A11 / S100C expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11140-M-FCHF230
    Humain S100A11 / S100C expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG11140-NFCHF230
    Humain S100A11 / S100C expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG11140-NHCHF230
    Humain S100A11 / S100C expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG11140-NMCHF230
    Humain S100A11 / S100C expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG11140-NYCHF230
    Humain S100A11 / S100C expression plasmide de Gène l'ADNc ORF cloneHG11140-UTCHF230
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name

    Protein S100-A11, also known as S100 calcium-binding protein A11, S100A11 and MLN70, is a member of the S-100 family. S100A11 is widely expressed in multiple tissues, and is located in cytoplasm, nucleus, and even cell periphery. S100A11 exists as a non-covalent homodimer with an antiparallel conformation. Ca(2+) binding to S100A11 would trigger conformational changes which would expose the hydrophobic cleft of S100A11 and facilitate its interaction with target proteins. As a dual cell growth mediator, S100A11 acts as either a tumor suppressor or promoter in many different types of tumors and would play respective roles in influencing the proliferation of the cancer cells. In the nucleus, S100A11 suppresses the growth of keratinocytes through p21 (CIP1/WAF1) activation and induces cell differentiation. S100A11 is also a novel diagnostic marker in breast carcinoma.

  • Miyasaki KT. et al., 1993, J Dent Res. 72: 517-23.
  • Ohuchida K. et al., 2006, Clin Cancer Res  12 (18): 5417-22.
  • Kouno T. et al., 2008, J Pept Sci. 14 (10): 1129-38.
  • He H. et al., 2009, Cell Biochem Biophys 55 (3): 117-26.
  • Liu XG. et al., 2010, Oncol Rep. 23 (5): 1301-8.
  • Size / Price
    Catalogue : HG11140-CY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.