After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain S100A12 expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human S100A12 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_005621.1
Taille du ADNc:279bp
Description du ADNc:Full length Clone DNA of Homo sapiens S100 calcium binding protein A5 with C terminal HA tag.
Synonyme du gène:p6, CAGC, CGRP, MRP6, CAAF1, ENRAGE, S100A12
Espèces:Human
Vecteur:pCMV3-C-HA
Plasmid:
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Fond

S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response. 

Protein S100-A12, also known as S100 calcium-binding protein A12, Calcium-binding protein in amniotic fluid 1, Calgranulin-C, and S100A12, is a member of the S-101 family. Like the majority of S100 proteins, S100A12 is a dimer, with the interface between the two subunits being composed mostly of hydrophobic residues. The fold of S100A12 is similar to the other known crystal and solution structures of S100 proteins, except for the linker region between the two EF-hand motifs. S100A12 plays an important role in the inflammatory response.

Références
  • Moroz, OV. et al., 2001, Acta Crystallogr D Biol Crystallogr. 57: 20-9.
  • Foell, D. et al., 2003, Lancet  361 (9365):1270-2.
  • Vogl, T. et al., 2004, Blood. 104: 4260-8.
  • Viemann, D. et al., 2005, Blood. 105: 2955-62.
  • Nakatani, Y. et al., 2005, Mediators Inflamm. 2005: 280-292.
  • Bjoerk, P. et al., 2009, PLoS Biol. 7: E97-E97.
  • Size / Price
    Catalogue : HG11143-CY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »