Commande rapide

Humain PS6K / RPS6KB1 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human RPS6KB1 Informations sur les produits clonés de cDNA
Taille du ADNc:1578bp
Description du ADNc:Full length Clone DNA of Homo sapiens ribosomal protein S6 kinase, 70kDa, polypeptide 1 with N terminal His tag.
Synonyme du gène:RPS6KB1, S6K, PS6K, S6K1, STK14A, p70-S6K, p70-alpha, p70(S6K)-alpha
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humain PS6K / RPS6KB1 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
Product nameProduct name

PS6K, also known as RPS6KB1, is a serine/threonine-protein kinase. It belongs to the RSK (ribosomal s6 kinase) family. Members of this family function in signal transduction. PS6K is an isoform of p70 ribosomal S6 kinase (S6K). S6K can be activated by mitogenic stimuli such as growth factors, insulin and cytokines. It phosphorylates the ribosomal protein S6. PS6K also phosphorylates other proteins such as elF4B, eEF2K and SKAR. It is a crucial effector of mTOR(rapamycin) signaling. PS6K is dissociated from the EIF3 complex and activated upon mitogenic stimulation, phosphorylation by the mammalian target of mTOR complex 1 (mTORC1). Its active form then phosphorylates and activates several substrates in the preinitiation complex, including the EIF2B complex and the cap-binding complex component EIF4B. PS6K also functions in cell proliferation, cell growth and cell cycle progression.

  • Panasyuk, et al. (2006) Nuclear export of PS6K II is regulated by protein kinase CK2 phosphorylation at Ser-17. J Biol Chem. 281(42):31188-201.
  • Carnevalli L, et al. (2010) PS6K Plays a Critical Role in Early Adipocyte Differentiation. Dev Cell. 18 (5):763-74.
  • Grove JR, et al. (1991) Cloning and expression of two human p70 S6 kinase polypeptides differing only at their amino termini. Mol Cell Biol. 11(11):5541-50.
  • Size / Price
    Catalogue : HG10099-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.