Commande rapide

Text Size:AAA

Humain KITLG/SCF/C-kit ligand expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human KITLG Informations sur les produits clonés de cDNA
Taille du ADNc:822bp
Description du ADNc:Full length Clone DNA of Homo sapiens KIT ligand with C terminal His tag.
Synonyme du gène:SF, MGF, SCF, KL-1, Kitl, SHEP7, DKFZp686F2250, KITLG
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name

Similar to Kit ligand precursor (C-kit ligand) , also known as Stem cell factor (SCF), Mast cell growth factor (MGF) or Hematopoietic growth factor KL. SCF/C-kit ligand is the ligand of the tyrosine-kinase receptor encoded by the KIT locus. This ligand is a pleiotropic factor that acts in utero in germ cell and neural cell development, and hematopoiesis, all believed to reflect a role in cell migration. In adults, it functions pleiotropically, while mostly noted for its continued requirement in hematopoiesis. SCF/C-kit ligand stimulates the proliferation of mast cells. This protein is able to augment the proliferation of both myeloid and lymphoid hematopoietic progenitors in bone marrow culture. It may act synergistically with other cytokines, probably interleukins SCF/C-kit ligand is the ligand for the tyrosine kinase receptor c-kit, which is expressed on both primitive and mature hematopoietic progenitor cells. In vitro, SCF/C-kit ligand synergizes with other growth factors, such as granulocyte colony-stimulating factor (G-CSF), granulocyte macrophage- colony- stimulating factor, and interleukin-3 to stimulate the proliferation and differentiation of cells of the lymphoid, myeloid, erythroid, and megakaryocytic lineages. In vivo, SCF/C-kit also synergizes with other growth factors and has been shown to enhance the mobilization of peripheral blood progenitor cells in combination with G-CSF. In phase I/II clinical studies administration of the combination of SCF and G-CSF resulted in a two- to threefold increase in cells that express the CD34 antigen compared with G-CSF alone.

  • McNiece IK, et al. (1995) Stem cell factor. J Leukoc Biol. 58(1): 14-22.
  • Besmer P, et al. (1993) The kit-ligand (steel factor) and its receptor c-kit/W: pleiotropic roles in gametogenesis and melanogenesis. Dev Suppl. 1993:125-37.
  • Mekori YA, et al. (1993) IL-3-dependent murine mast cells undergo apoptosis on removal of IL-3. Prevention of apoptosis by c-kit ligand. J Immunol. 151(7): 3775-84.
  • Size / Price
    Catalogue : HG10451-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.