Mammaglobin B / SCGB2A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Price:
Size:
Number:

Mammaglobin B / SCGB2A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
288 bp
Description
Full length Clone DNA of Human secretoglobin, family 2A, member 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Mammaglobin B / SCGB2A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

LIPHC cDNA ORF Clone, Human; LPHC cDNA ORF Clone, Human; LPNC cDNA ORF Clone, Human; MGB2 cDNA ORF Clone, Human; UGB3 cDNA ORF Clone, Human

Mammaglobin B / SCGB2A1 Background Information

SCGB2A1 represented a novel, prognostic factor for CRC, and that expression of SCGB2A1 correlated with chemoresistance, radioresistance and cancer cell stemness. SCGB2A1 is a top differentially expressed gene in all major histological types of ovarian cancers and may represent a novel and attractive target for the immunotherapy of patients harbouring recurrent disease resistant to chemotherapy.
Full Name
secretoglobin family 2A member 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait