Commande rapide

Humain SCLY / Selenocysteine Lyase expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human SCLY Informations sur les produits clonés de cDNA
Taille du ADNc:1338bp
Description du ADNc:Full length Clone DNA of Homo sapiens selenocysteine lyase with N terminal Myc tag.
Synonyme du gène:SCL, hSCL
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humain SCLY / Selenocysteine Lyase expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur on other vectors
Humain SCLY / Selenocysteine Lyase expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG14905-ACGCHF270
Humain SCLY / Selenocysteine Lyase expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG14905-ACRCHF270
Humain SCLY / Selenocysteine Lyase expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG14905-ANGCHF270
Humain SCLY / Selenocysteine Lyase expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG14905-ANRCHF270
Humain SCLY / Selenocysteine Lyase expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG14905-CFCHF230
Humain SCLY / Selenocysteine Lyase expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG14905-CHCHF230
Humain SCLY / Selenocysteine Lyase expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG14905-CMCHF230
Humain SCLY / Selenocysteine Lyase expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG14905-CYCHF230
Humain SCLY / Selenocysteine Lyase Gène ADNc clone le vecteur de clonageHG14905-GCHF90
Humain SCLY / Selenocysteine Lyase expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG14905-NFCHF230
Humain SCLY / Selenocysteine Lyase expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG14905-NHCHF230
Humain SCLY / Selenocysteine Lyase expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG14905-NMCHF230
Humain SCLY / Selenocysteine Lyase expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG14905-NYCHF230
Humain SCLY / Selenocysteine Lyase expression plasmide de Gène l'ADNc ORF cloneHG14905-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

SCLY, also known as selenocysteine lyase, belongs to the class-V pyridoxal-phosphate-dependent aminotransferase family. It is a novel enzyme that exclusively decomposes L-selenocysteine into L-alanine and H2Se in various mammalian tissues. SCLY contains pyridoxal 5'-phosphate and weighs approximately 85,000. SCLY participates in selenoamino acid metabolism. It employs one cofactor, pyridoxal phosphate. Its maximum reactivity is at about pH 9.0. It was shown that 1 mol of selenocysteine is converted to equimolar amounts of alanine and H2Se. The following amino acids are insert: L-cysteine, L-serine, L-cysteine sulfinate, selenocysteamine, Se-ethyl-DL-selenocysteine, and L-selenohomocysteine. L-Cysteine (Ki, 1.0 mM) competes with L-selenocysteine (Km, 0.83mM) to inhibit the enzyme reaction.

  • Johansson AL. et al., 2012, PLoS One. 7 (1): e30528.
  • Collins R. et al., 2012, PLoS One. 7 (1): e30581.
  • N Esaki. et al., 1982, The Journal of Biological Chemistry. 257: 4386-91.
  • Size / Price
    Catalogue : HG14905-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.