Commande rapide

Text Size:AAA

Humain Syndecan-1/CD138/SDC1 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human SDC1 Informations sur les produits clonés de cDNA
Taille du ADNc:933bp
Description du ADNc:Full length Clone DNA of Homo sapiens syndecan 11 with N terminal Myc tag.
Synonyme du gène:SDC, CD138, SYND1, syndecan, SDC1
Site de restriction:KpnI + XbaI (6kb + 0.96kb)
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 279G/A not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human SDC1 Gene Plasmid Map
Human SDC1 ORF mammalian expression plasmid, N-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

Syndecan-1 also known as SDC1 and CD138, is the most extensively studied member of the syndecan family. It is found mainly in epithelial cells, but its expression is developmentally regulated during embryonic development. Syndecan-1/SDC1/CD138 has been shown to mediate cell adhesion to several ECM molecules, and to act as a coreceptor for fibroblast growth factors, potent angiogenic growth factors involved also in differentiation. Syndecan-1/SDC1/CD138 expression is reduced during malignant transformation of various epithelia, and this loss correlates with the histological differentiation grade of squamous cell carcinomas, lacking from poorly differentiated tumours. In squamous cell carcinomas of the head and neck, positive syndecan-1 expression correlates with a more favourable prognosis. Experimental studies on the role of Syndecan-1 in malignant transformation have shown that Syndecan-1/SDC1/CD138 expression is associated with the maintenance of epithelial morphology, anchorage-dependent growth and inhibition of invasiveness in vitro.

  • Inki P, et al. (1996) The role of syndecan-1 in malignancies. Ann Med. 28(1): 63-7.
  • Subramanian SV, et al. (1997) Regulated shedding of syndecan-1 and -4 ectodomains by thrombin and growth factor receptor activation. J Biol Chem. 272(23): 14713-20.
  • Park PW, et al. (2001) Exploitation of syndecan-1 shedding by Pseudomonas aeruginosa enhances virulence. Nature. 411(6833): 98-102.
  • Size / Price
    Catalogue : HG11429-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    Contact Us
    • Human SDC1 ORF mammalian expression plasmid, N-Myc tag
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.