Commande rapide

Text Size:AAA

Humain Semaphorin 3A/SEMA3A expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human SEMA3A Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_006080.2
Taille du ADNc:2316bp
Description du ADNc:Full length Clone DNA of Homo sapiens sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A with N terminal His tag.
Synonyme du gène:SemD, SEMA1, SEMAD, SEMAL, coll-1, Hsema-I, SEMAIII, Hsema-III, MGC133243, SEMA3A
Espèces:Human
Vecteur:pCMV3-SP-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Fond

Semaphorins are a family of secreted and cell-bound signaling molecules defined by the presence of a common 500 aa Sema domain. They are best characterized in relation to axon guidance during development of the nervous system. The functions of Semaphorins 3A (SEMA3A) are mediated primarily through binding to the Neuropilin-1 (Npn-1) and Plexin-A1 coreceptor complex. Neuropilins lack a signaling-competent cytoplasetmic domain and ensure semaphorin binding, whereas the transmembrane receptor plexin mediates the intracellular response. As the first identified vertebrate semaphorin, SEMA3A functions either as a chemorepulsive agent inhibiting axonal outgrowth, or as a chemoattractive agent stimulating the growth of apical dendrites. In both cases, the protein is vital for normal neuronal pattern development. Its overexpression is associated with schizophrenia which is seen in various human tumor cell lines, and aberrant release is associated with the progression of Alzheimer's disease

Références
  • Giordano,A. et al., 2003, J Neurocytol.32(4):345-352.
  • Good, P. F. et al., 2005, J. Neurochem.91(3): 716-736.
  • Gu, C. et al., 2005, Science.307(5707): 265–268.
  • Chadborn,N.H. et al., 2006, J Cell Sci.119(Pt 5):951-957.
  • Schmidt,E.F. et al., 2007, Adv Exp Med Biol.600:1-11.
  • Size / Price
    Catalogue : HG10758-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »