SerpinA10 cDNA ORF Clone, Human, N-HA tag

Cat: HG10992-NY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All SerpinA10 Reagents

CRO Services

Product recommended


All SerpinA10 Reagents

SerpinA10 cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1335 bp
Description
Full length Clone DNA of Human serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10 with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SerpinA10 cDNA ORF Clone, Human, N-HA tag Alternative Names

PZI cDNA ORF Clone, Human;ZPI cDNA ORF Clone, Human

SerpinA10 Background Information

Protein Z-dependent protease inhibitor, also known as PZ-dependent protease inhibitor, SERPINA1 and ZPI, is a secreted protein which belongs to the serpin family. It is expressed by the liver and secreted in plasma. SERPINA1 / Serpin-A1 inhibits factor Xa activity in the presence of protein Z, calcium and phospholipid. Serpins are a group of proteins with similar structures that were first identified as a set of proteins able to inhibit proteases. The acronym serpin was originally coined because many serpins inhibit chymotrypsin-like serine proteases (serine protease inhibitors).Over 1 serpins have now been identified, these include 36 human proteins, as well as molecules in plants, fungi, bacteria, archaea and certain viruses. Serpins are the largest and most diverse family of protease inhibitors. Most serpins control proteolytic cascades, certain serpins do not inhibit enzymes, but instead perform diverse functions such as storage (ovalbumin, in egg white), hormone carriage proteins (thyroxine-binding globulin, cortisol-binding globulin) and tumor suppressor genes (maspin). Most inhibitory serpins target chymotrypsin-like serine proteases. These enzymes are defined by the presence of a nucleophilic serine residue in their catalytic site. Some serpins inhibit other classes of protease. A number of such serpins have been shown to target cysteine proteases. These enzymes differ from serine proteases in that they are defined by the presence of a nucleophilic cysteine residue, rather than a serine residue, in their catalytic site.
Full Name
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10
References
  • Han X, et al., 1998, Proc Natl Acad Sci. USA  95: 9250-5.
  • Han X, et al., 2000, Blood 96: 3049-55.
  • Irving JA, et al.,2000, Genome Res. 10 (12): 1845-64.
  • Irving J, et al.,2002, Mol Biol Evol. 19 (11): 1881-90.
  • Rawlings ND, et al.,2004, Biochem J. 378 (Pt 3): 705-16.
  • Water N, et al., 2004, Br J Haematol. 127:190-4.
  • Wei Z, et al., 2009, Blood 114 (17): 3662-7.
  • Whisstock JC, et al.,2010, J Biol Chem. 285 (32): 24307-12.
  • SerpinA10 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SerpinA10 cDNA ORF Clone in Cloning Vector, Mouse MG50315-M
    SerpinA10 cDNA ORF Clone, Mouse, untagged MG50315-UT
    SerpinA10 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50315-ACG
    SerpinA10 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50315-ACGLN
    SerpinA10 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50315-ACR
    SerpinA10 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50315-CF
    SerpinA10 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50315-NF
    SerpinA10 cDNA ORF Clone, Mouse, C-His tag MG50315-CH
    SerpinA10 cDNA ORF Clone, Mouse, N-His tag MG50315-NH
    SerpinA10 cDNA ORF Clone, Mouse, C-HA tag MG50315-CY
    SerpinA10 cDNA ORF Clone, Mouse, N-HA tag MG50315-NY
    SerpinA10 cDNA ORF Clone, Mouse, C-Myc tag MG50315-CM
    SerpinA10 cDNA ORF Clone, Mouse, N-Myc tag MG50315-NM
    SerpinA10 qPCR Primer Pairs, Mouse MP200338

    SerpinA10 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SerpinA10 cDNA ORF Clone in Cloning Vector, Human HG10992-M
    SerpinA10 cDNA ORF Clone, Human, untagged HG10992-UT
    SerpinA10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10992-ACGLN
    SerpinA10 cDNA ORF Clone, Human, C-GFPSpark® tag HG10992-ACG
    SerpinA10 cDNA ORF Clone, Human, C-OFPSpark® tag HG10992-ACR
    SerpinA10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10992-CF
    SerpinA10 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10992-NF
    SerpinA10 cDNA ORF Clone, Human, C-His tag HG10992-CH
    SerpinA10 cDNA ORF Clone, Human, N-His tag HG10992-NH
    SerpinA10 cDNA ORF Clone, Human, C-HA tag HG10992-CY
    SerpinA10 cDNA ORF Clone, Human, C-Myc tag HG10992-CM
    SerpinA10 cDNA ORF Clone, Human, N-Myc tag HG10992-NM
    SerpinA10 qPCR Primer Pairs, Human HP100955
    info info
    添加购物车成功! 添加购物车失败!