SERPINB1 cDNA ORF Clone, Human, N-HA tag

1/1
Price:
Size:
Number:

SERPINB1 cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1182 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human serpin peptidase inhibitor, clade B (ovalbumin), member 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.18kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SERPINB1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SERPINB1 cDNA ORF Clone, Human, N-HA tag: Validated Images

SERPINB1 cDNA ORF Clone, Human, N-HA tag: Alternative Names

EI cDNA ORF Clone, Human; ELANH2 cDNA ORF Clone, Human; HEL-S-27 cDNA ORF Clone, Human; HEL57 cDNA ORF Clone, Human; LEI cDNA ORF Clone, Human; M/NEI cDNA ORF Clone, Human; MNEI cDNA ORF Clone, Human; PI-2 cDNA ORF Clone, Human; PI2 cDNA ORF Clone, Human

SERPINB1 Background Information

SerpinB1 is an endogenous inhibitor of serine proteases recognized for its anti-inflammatory and host-protective properties. Serum SerpinB1 levels are elevated in patients with type 2 diabetes compared with that in healthy subjects and are negatively correlated with serum LDL-C. serpinB1 as an endogenous protein that can potentially be harnessed to enhance functional beta cell mass in patients with diabetes.
Full Name
serpin peptidase inhibitor, clade B (ovalbumin), member 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait