FATP4 cDNA ORF Clone, Human, C-Myc tag

Price:
Size:
Number:

FATP4 cDNA ORF Clone, Human, C-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
714 bp
Description
Full length Clone DNA of Human solute carrier family 27 (fatty acid transporter), member 4 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FATP4 cDNA ORF Clone, Human, C-Myc tag: Alternative Names

ACSVL4 cDNA ORF Clone, Human; FATP4 cDNA ORF Clone, Human; IPS cDNA ORF Clone, Human

FATP4 Background Information

SLC27A4/ATG4B complex might act as a new potential therapeutic target of lung tumor chemotherapy. The solute carrier 27A (SLC27A) gene family encodes fatty acid transport proteins (FATPs) and includes 6 members. Autism spectrum disorders (ASD) are now recognized as disorders caused by impaired early brain development, it is possible that functional abnormalities of SLC27A genes may contribute to the pathogenesis of ASD. The expression of SLC27A3 and SLC27A4 in human neural stem cells derived from human induced pluripotent stem cells, which suggested their involvement in the developmental stage of the central nervous system.
Full Name
solute carrier family 27 (fatty acid transporter), member 4
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait