Commande rapide

Text Size:AAA

Humain ASM3A / SMPDL3A expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human SMPDL3A Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC018999
Taille du ADNc:1362bp
Description du ADNc:Full length Clone DNA of Homo sapiens sphingomyelin phosphodiesterase, acid-like 3A with C terminal Myc tag.
Synonyme du gène:ASM3A, ASML3a, yR36GH4.1, SMPDL3A
Espèces:Human
Vecteur:pCMV3-C-Myc
Plasmid:
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Fond

SMPDL3A gene is a novel liver X receptor (LXR) -regulated gene, with an LXR response element within its promoter. The induction of SMPDL3A is LXR-dependent and is restricted to human blood cells with no induction observed in mouse cellular systems. LXR α and LXRβ function as physiological sensors of cholesterol metabolites (oxysterols), regulating key genes involved in cholesterol and lipid metabolism. LXRs have been extensively studied in both human and rodent cell systems, revealing their potential therapeutic value in the contexts of atherosclerosis and inflammatory diseases. The LXR genome landscape has been investigated in murine macrophages but not in human THP-1 cells, which represent one of the frequently used monocyte/macrophage cell systems to study immune responses.

Références
  • Wright KO, et al. (2002) Increased expression of the acid sphingomyelinase-like protein ASML3a in bladder tumors. J Urol. 168(6):2645-9.
  • Strausberg RL, et al. (2002) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Mungall AJ, et al. (2003) The DNA sequence and analysis of human chromosome 6. Nature. 425(6960):805-11.
  • Size / Price
    Catalogue : HG13559-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »