Commande rapide

Humain SMYD3 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human SMYD3 Informations sur les produits clonés de cDNA
Taille du ADNc:1287bp
Description du ADNc:Full length Clone DNA of Homo sapiens SET and MYND domain containing 3 transcript variant 1 with N terminal Flag tag.
Synonyme du gène:KMT3E, ZMYND1, ZNFN3A1, FLJ21080, MGC104324, bA74P14.1, SMYD3
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humain SMYD3 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur on other vectors
Humain SMYD3 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG11230-ACGCHF270
Humain SMYD3 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG11230-ACRCHF270
Humain SMYD3 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG11230-ANGCHF270
Humain SMYD3 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG11230-ANRCHF270
Humain SMYD3 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11230-CFCHF90
Humain SMYD3 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG11230-CHCHF230
Humain SMYD3 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG11230-CMCHF230
Humain SMYD3 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG11230-CYCHF230
Humain SMYD3 transcript variant 1 Gène ADNc clone le vecteur de clonageHG11230-GCHF90
Humain SMYD3 transcript variant 1 Gène ADNc clone le vecteur de clonageHG11230-MCHF90
Humain SMYD3 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG11230-NFCHF230
Humain SMYD3 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG11230-NHCHF230
Humain SMYD3 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG11230-NMCHF230
Humain SMYD3 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG11230-NYCHF230
Humain SMYD3 transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG11230-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

SET and MYND domain-containing protein 3, also known as Zinc finger MYND domain-containing protein 1, SMYD3, and ZMYND, is a member of the histone-lysine methyltransferase family. SMYD3 contains one MYND-type zinc finger and one SET domain. SMYD3 is a histone H3 lysine-4-specific methyltransferase. It is expressed in skeletal muscles and testis. It is overexpressed in a majority of colorectal carcinoma (CRC) and hepatocellular carcinoma (HCC). SMYD3 plays an important role in transcriptional regulation in human carcinogenesis. It activates the transcription of a set of downstream genes. Of these downstream genes, there are several oncogenes and genes associated with cell adhesion (including those of N-Myc, CrkL, Wnt10b, L-selectin, CD31 and galectin-4), which have been shown to have effects on cell viability, adhesion, migration and metastasis. Increased SMYD3 expression is essential for the proliferation of breast cancer cells. SMYD3 may be a promising new target of therapeutic intervention for the treatment of cancers or other pathological processes associated with cell adhesion and migration.

  • Hamamoto, R. et al., 2006, Cancer Sci. 97 (2): 113-8.
  • Luo, XG. et al., 2007, J Biosci Bioeng. 103 (5): 444-50.
  • Wang, XQ. et al., 2007, Exp Oncol. 29 (1): 71-3.
  • Silva, FP. et al., 2008, Oncogene. 27 (19): 2686-92.
  • Size / Price
    Catalogue : HG11230-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.