After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human SNAI2 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_003068.3
Taille du ADNc:807bp
Description du ADNc:Full length Clone DNA of Homo sapiens snail homolog 2 (Drosophila).
Synonyme du gène:SLUG, WS2D, SLUGH1, MGC10182, SNAI2
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:pCMV3-SNAI2
Site de restriction:KpnI + NotI (6.1kb + 0.81kb)
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human SNAI2 Gene Plasmid Map
Human SNAI2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone on other vectors
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG11196-ACGCHF270
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG11196-ACRCHF270
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG11196-ANGCHF270
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG11196-ANRCHF270
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11196-CFCHF230
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG11196-CHCHF230
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG11196-CMCHF230
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG11196-CYCHF230
Humain SNAI2 / Snail2 / slug Gène ADNc clone le vecteur de clonageHG11196-MCHF90
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11196-M-FCHF230
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG11196-NFCHF230
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG11196-NHCHF230
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG11196-NMCHF230
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG11196-NYCHF230
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF cloneHG11196-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG11196-UT
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
DisponibilitéIn Stock
Bulk Discount RequiryAjouter au panier
Contact Us
Images
  • Human SNAI2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »