Commande rapide

Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone

  • Human SNAI2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Fiche techniqueCommentairesProduits apparentésProtocoles
Humain SNAI2 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_003068.3
Taille du ADNc:807bp
Description du ADNc:Full length Clone DNA of Homo sapiens snail homolog 2 (Drosophila).
Synonyme du gène:SLUG, WS2D, SLUGH1, MGC10182, SNAI2
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:pCMV3-SNAI2
Site de restriction:KpnI + NotI (6.1kb + 0.81kb)
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with SNAI2 qPCR primers for gene expression analysis, HP101101 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Humain SNAI2 Gene Plasmid Map
Human SNAI2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone on other vectors
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG11196-ACGCHF270
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG11196-ACRCHF270
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG11196-ANGCHF270
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG11196-ANRCHF270
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11196-CFCHF230
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG11196-CHCHF230
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG11196-CMCHF230
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG11196-CYCHF230
Humain SNAI2 / Snail2 / slug Gène ADNc clone le vecteur de clonageHG11196-MCHF90
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11196-M-FCHF230
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG11196-NFCHF230
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG11196-NHCHF230
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG11196-NMCHF230
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG11196-NYCHF230
Humain SNAI2 / Snail2 / slug expression plasmide de Gène l'ADNc ORF cloneHG11196-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG11196-UT
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité
Ajouter au panierBulk Discount Requiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »