Commande rapide

Text Size:AAA

Humain SPG3A/ATL1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human ATL1 Informations sur les produits clonés de cDNA
Taille du ADNc:1677bp
Description du ADNc:Full length Clone DNA of Homo sapiens atlastin GTPase 1 , transcript variant 1 with N terminal HA tag.
Synonyme du gène:FSP1, GBP3, SPG3, SPG3A, AD-FSP, atlastin1
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humain SPG3A/ATL1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur on other vectors
Humain SPG3A/ATL1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10523-ACGCHF290
Humain SPG3A/ATL1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10523-ACRCHF290
Humain SPG3A/ATL1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10523-ANGCHF290
Humain SPG3A/ATL1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10523-ANRCHF290
Humain SPG3A/ATL1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10523-CFCHF260
Humain SPG3A/ATL1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10523-CHCHF260
Humain SPG3A/ATL1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10523-CMCHF260
Humain SPG3A/ATL1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10523-CYCHF260
Humain SPG3A/ATL1 transcript variant 1 Gène ADNc clone le vecteur de clonageHG10523-MCHF90
Humain SPG3A/ATL1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10523-M-FCHF260
Humain SPG3A/ATL1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10523-NFCHF260
Humain SPG3A/ATL1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10523-NHCHF260
Humain SPG3A/ATL1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10523-NMCHF260
Humain SPG3A/ATL1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10523-NYCHF260
Humain SPG3A/ATL1 transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG10523-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Atlastin-1, also known as Spastic paraplegia 3 protein A, Guanine nucleotide-binding protein 3, GTP-binding protein 3, GBP3, ATL1 and SPG3A, is a multi-pass membrane protein which belongs to the GBP family and atlastin subfamily. ATL1 / SPG3A is expressed predominantly in the adult and fetal central nervous system. Expression of ATL1 / SPG3A in adult brain is at least 50-fold higher than in other tissues. ATL1 / SPG3A is detected predominantly in pyramidal neurons in the cerebral cortex and the hippocampus of the brain. ATL1 / SPG3A is also expressed in upper and lower motor neurons (at protein level). A distinguishing feature of ATL1 / SPG3A is its frequent early onset, raising the possibility that developmental abnormalities may be involved in its pathogenesis. Missense SPG3A mutant atlastin-1 proteins have impaired GTPase activity and may act in a dominant-negative, loss-of-function manner by forming mixed oligomers with wild-type atlastin-1. Defects in ATL1 / SPG3A are the cause of spastic paraplegia autosomal dominant type 3 (SPG3), also known as Strumpell-Lorrain syndrome. Spastic paraplegia is a degenerative spinal cord disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs.

Size / Price
Catalogue : HG10523-NY
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.