SPINK2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Price:
Size:
Number:

SPINK2 cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
254 bp
Description
Full length Clone DNA of Human serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SPINK2 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

HUSI-II cDNA ORF Clone, Human; SPINK2 cDNA ORF Clone, Human

SPINK2 Background Information

Human serine proteinase inhibitor Kazal-type 2 (SPINK2) functions as a trypsin/acrosin inhibitor and is synthesized mainly in the testis and seminal vesicle where its activity is engaged in fertility. The SPINK2 protein contains a typical Kazal domain composed by six cysteine residues forming three disulfide bridges. The expression of SPINK2 is closely related to cancer such as lymphomas, in that a high transcript level of SPINK2 in patients with primary cutaneous follicle center cell lymphomas have better prognosis with lower mortality. SPINK2 is necessary to neutralize proteases during their cellular transit toward the acrosome and that its deficiency induces a pathological continuum ranging from oligoasthenoteratozoospermia in heterozygotes to azoospermia in homozygotes.
Full Name
serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait