Commande rapide

Text Size:AAA

Humain SRC/Proto-oncogene c-Src expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human SRC Informations sur les produits clonés de cDNA
Taille du ADNc:1611bp
Description du ADNc:Full length Clone DNA of Homo sapiens v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) with N terminal His tag.
Synonyme du gène:ASV, SRC1, c-SRC, p60-Src, SRC
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humain SRC/Proto-oncogene c-Src expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
Humain SRC/Proto-oncogene c-Src expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10755-ACGCHF290
Humain SRC/Proto-oncogene c-Src expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10755-ACRCHF290
Humain SRC/Proto-oncogene c-Src expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10755-ANGCHF290
Humain SRC/Proto-oncogene c-Src expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10755-ANRCHF290
Humain SRC/Proto-oncogene c-Src expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10755-CFCHF260
Humain SRC/Proto-oncogene c-Src expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10755-CHCHF260
Humain SRC/Proto-oncogene c-Src expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10755-CMCHF260
Humain SRC/Proto-oncogene c-Src expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10755-CYCHF260
Humain SRC/Proto-oncogene c-Src Gène ADNc clone le vecteur de clonageHG10755-MCHF90
Humain SRC/Proto-oncogene c-Src expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10755-NFCHF260
Humain SRC/Proto-oncogene c-Src expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10755-NHCHF260
Humain SRC/Proto-oncogene c-Src expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10755-NMCHF260
Humain SRC/Proto-oncogene c-Src expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10755-NYCHF260
Humain SRC/Proto-oncogene c-Src expression plasmide de Gène l'ADNc ORF cloneHG10755-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Proto-oncogene tyrosine-protein kinase SRC is a hydrophobic protein belonging to the SRC family kinase including nine members that is a family of non-receptor tyrosine kinases. SRC protein may exist in different forms: C-SRC and V-SRC. C-SRC is only activated under certain circumstances where it is required such as growth factor signaling, while V-SRC is a constitutively active as opposed to normal SRC (C-SRC). Thus, V-SRC is an instructive example of an oncogene protein kinase whereas C-SRC is a proto-oncogene protein kinase. Inhibition of SRC with NR2A tyrosine phosphorylation mediated by PSD-95 may contribute to the lithium-induced downregulation of NMDA receptor function and provide neuroprotection against excitotoxicity.

  • Juan Ma. et al., 2003, Neuroscience Letters. 348 (3): 185-189.
  • Czernilofsky AP. et al., 1980, Nature. 287: 198-203.
  • Beischlag TV. et al., 2002, Molecular and cellular biology. 22 (12): 4319-33.
  • Size / Price
    Catalogue : HG10755-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.