SRP9 cDNA ORF Clone, Human, N-His tag

Cat: HG16165-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SRP9 Reagents
CRO Services
Product recommended

All SRP9 Reagents
SRP9 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
261 bp
Description
Full length Clone DNA of Human signal recognition particle 9kDa with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SRP9 cDNA ORF Clone, Human, N-His tag Alternative Names
ALURBP cDNA ORF Clone, Human
SRP9 Background Information
Full Name
signal recognition particle 9kDa

SRP9 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
SRP9 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90774-G
SRP9 cDNA ORF Clone, Cynomolgus, untagged CG90774-UT
SRP9 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90774-ACG
SRP9 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90774-ACGLN
SRP9 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90774-ANG
SRP9 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90774-ACR
SRP9 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90774-ANR
SRP9 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90774-CF
SRP9 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90774-NF
SRP9 cDNA ORF Clone, Cynomolgus, C-His tag CG90774-CH
SRP9 cDNA ORF Clone, Cynomolgus, N-His tag CG90774-NH
SRP9 cDNA ORF Clone, Cynomolgus, C-HA tag CG90774-CY
SRP9 cDNA ORF Clone, Cynomolgus, N-HA tag CG90774-NY
SRP9 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90774-CM
SRP9 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90774-NM

SRP9 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SRP9 cDNA ORF Clone in Cloning Vector, Mouse MG51980-G
SRP9 cDNA ORF Clone, Mouse, untagged MG51980-UT
SRP9 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51980-ACG
SRP9 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51980-ACGLN
SRP9 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51980-ANG
SRP9 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51980-ACR
SRP9 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51980-ANR
SRP9 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51980-CF
SRP9 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51980-NF
SRP9 cDNA ORF Clone, Mouse, C-His tag MG51980-CH
SRP9 cDNA ORF Clone, Mouse, N-His tag MG51980-NH
SRP9 cDNA ORF Clone, Mouse, C-HA tag MG51980-CY
SRP9 cDNA ORF Clone, Mouse, N-HA tag MG51980-NY
SRP9 cDNA ORF Clone, Mouse, C-Myc tag MG51980-CM
SRP9 cDNA ORF Clone, Mouse, N-Myc tag MG51980-NM
SRP9 qPCR Primer Pairs, Mouse MP201853

SRP9 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SRP9 cDNA ORF Clone in Cloning Vector, Human HG16165-G
SRP9 cDNA ORF Clone, Human, untagged HG16165-UT
SRP9 cDNA ORF Clone, Human, C-GFPSpark® tag HG16165-ACG
SRP9 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG29655-ACGLN
SRP9 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16165-ACGLN
SRP9 cDNA ORF Clone, Human, N-GFPSpark® tag HG16165-ANG
SRP9 cDNA ORF Clone, Human, C-OFPSpark® tag HG16165-ACR
SRP9 cDNA ORF Clone, Human, N-OFPSpark® tag HG16165-ANR
SRP9 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16165-CF
SRP9 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16165-NF
SRP9 cDNA ORF Clone, Human, C-His tag HG16165-CH
SRP9 cDNA ORF Clone, Human, C-HA tag HG16165-CY
SRP9 cDNA ORF Clone, Human, N-HA tag HG16165-NY
SRP9 cDNA ORF Clone, Human, C-Myc tag HG16165-CM
SRP9 cDNA ORF Clone, Human, N-Myc tag HG16165-NM
SRP9 qPCR Primer Pairs, Human HP104934
info info
添加购物车成功! 添加购物车失败!