Statherin cDNA ORF Clone, Human, N-DDK (Flag®) tag

Price:
Size:
Number:

Statherin cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
189 bp
Description
Full length Clone DNA of Human statherin with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Statherin cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

STATH cDNA ORF Clone, Human; STR cDNA ORF Clone, Human

Statherin Background Information

Statherin, also known as STATH, belongs to the histatin/statherin family. Statherin may play an important role in the maintenance of oral health.It prevents calcium phospate precipitation in saliva, so maintaining a high calcium level in saliva and preventing teeth from dissolving. Statherin also inhibits spontaneous precipitation of calcium phosphate salts. Thus, statherin and PRPs may prevent build-up of harmful deposits in the salivary glands and on the tooth surfaces.Statherin is a highly stable salivary protein of low molecular mass (5,38). Sabatini et al. synthesized mixed oligonucleotides based on the known amino acid sequence of statherin and used these to screen a cDNA library constructed from human parotid gland mRNA.
Full Name
statherin
References
  • Sabatini LM. et al., 1998, Am J Hum Genet. 41 (6): 1048-60.
  • Schlesinger DH. et al., 1997, J Biol Chem. 252 (5): 1689-95.
  • Raj PA. et al., 1992, J Biol Chem. 267 (9): 5968-76.
  • Douglas WH. et al., 1991, Biochem Biophys Res Commun. 180 (1): 91-7.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait