Commande rapide

Humain STIM1 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human STIM1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_003156.3
Taille du ADNc:2058bp
Description du ADNc:Full length Clone DNA of Homo sapiens stromal interaction molecule 1 with N terminal Myc tag.
Synonyme du gène:GOK, D11S4896E, STIM1
Espèces:Human
Vecteur:pCMV3-SP-N-Myc
Plasmid:
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Fond

Stromal interaction molecule 1, also known as STIM1 and GOK, is a cell membrane, a single-pass type I  membrane protein and a endoplasmic reticulum membrane protein. STIM1 / GOK is ubiquitously expressed in various human primary cells and tumor cell lines. It contains one EF-hand domain and one SAM (sterile alpha motif) domain. STIM1 / GOK plays a role in mediating Ca2+ influx following depletion of intracellular Ca2+ stores. It acts as Ca2+ sensor in the endoplasmic reticulum via its EF-hand domain. Upon Ca2+ depletion, STIM1 / GOK translocates from the endoplasmic reticulum to the plasma membrane where it activates the Ca2+ release-activated Ca2+ (CRAC) channel subunit, TMEM142A / ORAI1. Transfection of STIM1 / GOK into cells derived from a rhabdoid tumor and from a rhabdomyosarcoma that do not express detectable levels of STIM1 can induce cell death, suggesting a possible role in the control of rhabdomyosarcomas and rhabdoid tumors. Defects in STIM1 are the cause of immune dysfunction with T-cell inactivation due to calcium entry defect type 2 (IDTICED2) which is an immune disorder characterized by recurrent infections, impaired T-cell activation and proliferative response, decreased T-cell production of cytokines, lymphadenopathy, and normal lymphocytes counts and serum immunoglobulin levels.

Références
  • Sabbioni S. et al., 1997, Cancer Res. 57: 4493-7.
  • Manji S.S. et al., 2000, Biochim. Biophys. Acta 1481: 147-55.
  • Williams R.T. et al., 2002, Biochim. Biophys. Acta. 1596: 131-7.
  • Spassova M.A. et al., 2006, Proc. Natl. Acad. Sci. USA. 103: 4040-5.
  • Parvez S. et al., 2008, FASEB J. 22: 752-61.
  • Size / Price
    Catalogue : HG11434-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »