After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain SYT6 / Synaptotagmin VI expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human SYT6 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC044948
Taille du ADNc:1278bp
Description du ADNc:Full length Clone DNA of Homo sapiens synaptotagmin VI DNA.
Synonyme du gène:sytVI
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Humain SYT6 / Synaptotagmin VI expression plasmide de Gène l'ADNc ORF clone on other vectors
Humain SYT6 / Synaptotagmin VI expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG15218-ACGCHF270
Humain SYT6 / Synaptotagmin VI expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG15218-ACRCHF270
Humain SYT6 / Synaptotagmin VI expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG15218-ANGCHF270
Humain SYT6 / Synaptotagmin VI expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG15218-ANRCHF270
Humain SYT6 / Synaptotagmin VI expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG15218-CFCHF230
Humain SYT6 / Synaptotagmin VI expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG15218-CHCHF230
Humain SYT6 / Synaptotagmin VI expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG15218-CMCHF230
Humain SYT6 / Synaptotagmin VI expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG15218-CYCHF230
Humain SYT6 / Synaptotagmin VI Gène ADNc clone le vecteur de clonageHG15218-GCHF90
Humain SYT6 / Synaptotagmin VI expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG15218-NFCHF230
Humain SYT6 / Synaptotagmin VI expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG15218-NHCHF230
Humain SYT6 / Synaptotagmin VI expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG15218-NMCHF230
Humain SYT6 / Synaptotagmin VI expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG15218-NYCHF230
Humain SYT6 / Synaptotagmin VI expression plasmide de Gène l'ADNc ORF cloneHG15218-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG15218-UT
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »