Commande rapide

Text Size:AAA

Human SerpinC1 ORF mammalian expression plasmid, N-Myc tag

Fiche techniqueCommentairesProduits apparentésProtocoles
Human SERPINC1 Informations sur les produits clonés de cDNA
Taille du ADNc:1395bp
Description du ADNc:Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade C (antithrombin), member 1 with N terminal Myc tag.
Synonyme du gène:AT3, ATIII, MGC22579
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

SerpinC1, also known as antithrombin III (AT III), is a member of the serpin superfamily of serine protease inhibitors, and has been found to be a marker for disseminated intravascular coagulation (DIC) and to be of prognostic significance in septic patients. SerpinC1 synthesized in the liver is the principal plasma serpin of blood coagulation proteases and inhibits thrombin and other factors such as Xa by the formation of covalently linked complexes. Thus it is one of the most important coagulation inhibitors and the fundamental enzyme for the therapeutical action of heparin. In common with SerpinA5 and D1, the inhibitory activity of SerpinC1 undergoes a dramatic increase in the presence of heparin and other glycosaminoglycans. ATIII mediates the promotion of prostaglandin release, an inhibitor of leucocyte activation and downregulator of many proinflammatory cytokines. Antithrombin III exerts anti-inflammatory properties in addition to its anti-coagulative mechanisms. In animal models of sepsis, ATIII affected cytokine plasma concentrations with a decrease of pro-inflammatory cytokines. The deficiency or functional abnormality of ATIII may result in an increased risk of thromboembolic disease, such as deep vein thrombosis and pulmonary embolism. In addition, it has been reported that SerpinC1 can alter or influence inflammatory processes via inhibition of NF-κB activation or actin polymerization.

  • de Sousa JC, et al. (1991) Antithrombin III. Physiologic, physiopathologic and laboratory aspects. Rev Port Cardiol. 10(9): 693-9.
  • Totzke G, et al. (2001) Antithrombin III enhances inducible nitric oxide synthase gene expression in vascular smooth muscle cells. Cell Immunol. 208(1): 1-8.
  • Ostermann H. (2002) Antithrombin III in Sepsis. New evidences and open questions. Minerva Anestesiol. 68(5): 445-8.
  • Caglikulekci M, et al. (2004) Effect of antithrombin-III (AT-III) on intestinal epithelium changes related to obstructive icterus: experimental study in rats. Ann Chir. 129(5): 273-7.
  • Size / Price
    Catalogue : HG10142-NM
    Prix catalogue :   (Save )
    Prix :      [How to order]
     Instructions d’expédition
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.