PAI-1 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

PAI-1 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1209 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human serpin peptidase inhibitor, clade E(nexin,plasminogen activator inhibitor type 1), member 1.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6.1kb + 1.21kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PAI-1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PAI-1 cDNA ORF Clone, Human, untagged: Alternative Names

PAI cDNA ORF Clone, Human; PAI-1 cDNA ORF Clone, Human; PAI1 cDNA ORF Clone, Human; PLANH1 cDNA ORF Clone, Human; SERPINE1 cDNA ORF Clone, Human

PAI-1 Background Information

Plasminogen activator inhibitor 1, also known as PAI-1, Endothelial plasminogen activator inhibitor, SerpinE1 and PLANH1, is a secreted glycoprotein which belongs to the serpin family. SerpinE1 is the primary physiological inhibitor of the two plasminogen activators urokinase (uPA) and tissue plasminogen activator (tPA). Its rapid interaction with TPA may function as a major control point in the regulation of fibrinolysis. Defects in SerpinE1 are the cause of plasminogen activator inhibitor-1 deficiency (PAI-1 deficiency) which is characterized by abnormal bleeding due to SerpinE1 defect in the plasma. High concentrations of SerpinE1 have been associated with thrombophilia which is an autosomal dominant disorder in which affected individuals are prone to develop serious spontaneous thrombosis. Studies of PAI-1 have contributed significantly to the elucidation of the protease inhibitory mechanism of serpins, which is based on a metastable native state becoming stabilised by insertion of the RCL into the central beta-sheet A and formation of covalent complexes with target proteases. Greater expression of PAI-1 has been associated with increased survival of cells and resistance to apoptosis. PAI-1 appears to influence apoptosis by decreasing cell adhesion (anoikis) as well as its effect on intracellular signaling. PAI-1, in its active state, also binds to the extracellular protein vitronectin. When in complex with its target proteases, it binds with high affinity to endocytosis receptors of the low density receptor family. The mechanisms of PAI-1 overexpression during obesity are complex, and it is conceivable that several inducers are involved at the same time at several sites of synthesis. PAI-1 is also implicated in adipose tissue development. It suggests that PAI-1 inhibitors serve in the control of atherothrombosis.
Full Name
serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1
References
  • Alessi MC, et al. (2006) PAI-1 and the metabolic syndrome: links, causes, and consequences. Arterioscler Thromb Vasc Biol. 26(10): 2200-7.
  • Schneider DJ, et al. (2008) The effect of plasminogen activator inhibitor type 1 on apoptosis. Thromb Haemost. 100(6): 1037-40.
  • Dupont DM, et al. (2009) Biochemical properties of plasminogen activator inhibitor-1. Front Biosci. 14: 1337-61.
  • Plasminogen activator inhibitor-1 is an independent prognostic factor of ovarian cancer and IMD-4482, a novel plasminogen activator inhibitor-1 inhibitor, inhibits ovarian cancer peritoneal dissemination
    Author
    Nakatsuka, E;Sawada, K;Nakamura, K;Yoshimura, A;Kinose, Y;Kodama, M;Hashimoto, K;Mabuchi, S;Makino, H;Morii, E;Yamaguchi, Y;Yanase, T;Itai, A;Morishige, KI;Kimura, T;
    Year
    2017
    Journal
    Oncotarget
    Application
    expression
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait