Commande rapide

Humain Humain Serum Albumin / HSA / HAS / ALB expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

  • Human Serum Albumin / HSA / ALB Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
  • Human Serum Albumin / HSA / ALB natural ORF mammalian expression plasmid, C-Flag tag
Fiche techniqueCommentairesProduits apparentésProtocoles
Humain ALB Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_000477.5
Taille du ADNc:1830bp
Description du ADNc:Full length Clone DNA of Homo sapiens albumin with C terminal Flag tag.
Synonyme du gène:PRO0883, PRO0903, PRO1341, DKFZp779N1935, ALB
Espèces:Human
Vecteur:pCMV3-C-FLAG
Plasmid:pCMV3-ALB-Flag
Site de restriction:KpnI + NotI (6kb + 1.88kb)
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:Identical with the Gene Bank Ref. ID sequence except for the point mutation 135 C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ALB qPCR primers for gene expression analysis, HP100843 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Humain ALB Gene Plasmid Map
Human Serum Albumin / HSA / ALB Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
Humain ALB Gene Expression validated Image
Human Serum Albumin / HSA / ALB natural ORF mammalian expression plasmid, C-Flag tag
[Cliquer pour agrandir l’image]
Caption:
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humain Humain Serum Albumin / HSA / HAS / ALB expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur on other vectors
Product nameProduct name
Size / Price
Catalogue : HG10968-CF
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité
Ajouter au panierBulk Discount Requiry

Datasheet & Documentation

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »