Commande rapide

Humain Tubulin folding cofactor A expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human TBCA Informations sur les produits clonés de cDNA
Taille du ADNc:327bp
Description du ADNc:Full length Clone DNA of Homo sapiens tubulin folding cofactor A with C terminal Flag tag.
Synonyme du gène:TBCA
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humain Tubulin folding cofactor A expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur on other vectors
Humain Tubulin folding cofactor A expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG13918-ACGCHF270
Humain Tubulin folding cofactor A expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG13918-ACRCHF270
Humain Tubulin folding cofactor A expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG13918-ANGCHF270
Humain Tubulin folding cofactor A expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG13918-ANRCHF270
Humain Tubulin folding cofactor A expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG13918-CFCHF230
Humain Tubulin folding cofactor A expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG13918-CHCHF230
Humain Tubulin folding cofactor A expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG13918-CMCHF230
Humain Tubulin folding cofactor A expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG13918-CYCHF230
Humain Tubulin folding cofactor A Gène ADNc clone le vecteur de clonageHG13918-GCHF90
Humain Tubulin folding cofactor A expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG13918-NFCHF230
Humain Tubulin folding cofactor A expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG13918-NHCHF230
Humain Tubulin folding cofactor A expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG13918-NMCHF230
Humain Tubulin folding cofactor A expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG13918-NYCHF230
Humain Tubulin folding cofactor A expression plasmide de Gène l'ADNc ORF cloneHG13918-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Tubulin folding cofactor A belongs to the TBCA family. It is one of four proteins (cofactors A, D, E, and C) involved in the early step of the tubulin folding pathway. These proteins can fold intermediates and finally lead to correctly folded beta-tubulin. It is believed that tubulin folding cofactors A and D play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Tubulin folding cofactor E binds to the cofactor D/beta-tubulin complex; interaction with tubulin folding cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state.

  • Strausberg RL, et al. (2002) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Irwin DM, et al. (2003) Molecular evolution of vertebrate goose-type lysozyme genes. J Mol Evol. 56(2):234-42.
  • Sklar P, et al. (2011) Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. Nat Genet. 43(10):977-83.
  • Size / Price
    Catalogue : HG13918-CF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.