Commande rapide

Humain TBCB expression plasmide de Gène l'ADNc ORF clone

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Humain TBCB Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:BC005969
    Taille du ADNc:735bp
    Description du ADNc:Full length Clone DNA of Homo sapiens tubulin folding cofactor B.
    Synonyme du gène:CG22, CKAP1, CKAPI, MGC14625
    Espèces:Human
    Vecteur:pCMV3-untagged
    Plasmid:
    Site de restriction:
    Séquence du marqueur:
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TBCB qPCR primers for gene expression analysis, HP102910 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Fond

    Tubulin-folding cofactor B, also known as TBCB, belongs to the TBCB family. It contains 1 CAP-Gly domain and can be detected in most tissues. TBCB binds to alpha-tubulin folding intermediates after their interaction with cytosolic chaperonin in the pathway. The cytoskeleton is composed of 3 structural elements: actin filaments, microtubules, and intermediate filaments. TBCB is involved in regulation of tubulin heterodimer dissociation. It may function as a negative regulator of axonal growth.

    Références
  • Feingold EA, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Tian G, et al. (1997) Tubulin subunits exist in an activated conformational state generated and maintained by protein cofactors. J Cell Biol. 138(4):821-32.
  • Wolz W, et al. (1997) A complex satellite DNA polymorphism flanking the human ryanodine receptor gene (RYR1). Cytogenet Cell Genet. 72(2-3):215-6.
  • Size / Price
    Catalogue : HG14260-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »