Cripto cDNA ORF Clone, Human, N-DDK (Flag®) tag

Price:
Size:
Number:

Cripto cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
567 bp
Description
Full length Clone DNA of Human teratocarcinoma-derived growth factor 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Cripto cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

CR cDNA ORF Clone, Human; CRGF cDNA ORF Clone, Human; CRIPTO cDNA ORF Clone, Human

Cripto Background Information

Cripto/TDGF1 is a member of the epidermal growth factor (EGF)- Cripto, Frl-1, and Cryptic (CFC) family. EGF-CFC family member proteins share a variant EGF-like motif, a conserved cysteine-rich domain, and a C-terminal hydrophobic region. Before gastrulation, Cripto is asymmetrically expressed in a proximal–distal gradient in the epiblast, and subsequently is expressed in the primitive streak and newly formed embryonic mesoderm. These proteins play key roles in intercellular signaling pathways during vertebrate embryogenesis. Mutations in Cripto/TDGF1 can cause autosomal visceral heterotaxy. Cripto/TDGF1 is involved in left-right asymmetric morphogenesis during organ development. Cripto signalling is essential for the conversion of a proximal–distal asymmetry into an orthogonal anterior–posterior axis. The mechanism of inhibitory effects of the Cripto includes both cancer cell apoptosis, activation of c-Jun-NH(2)-terminal kinase and p38 kinase signaling pathways and blocking of Akt phosphorylation. Thus, Cripto is a unique target, and Immunohistochemistry to Cripto could be of therapeutic value for human cancers.
Full Name
teratocarcinoma-derived growth factor 1
References
  • Calvanese L, et al. (2006) Solution structure of mouse Cripto CFC domain and its inactive variant Trp107Ala. J Med Chem. 49 (24): 7054-62.
  • Lonardo E, et al. (2010) A small synthetic cripto blocking Peptide improves neural induction, dopaminergic differentiation, and functional integration of mouse embryonic stem cells in a rat model of Parkinson's disease. Stem Cells. 28 (8): 1326-37.
  • Chambery A, et al. (2009) Qualitative and quantitative proteomic profiling of cripto(-/-) embryonic stem cells by means of accurate mass LC-MS analysis. J Proteome Res. 8 (2): 1047-58.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait