TGF beta 1 cDNA ORF Clone, Human, C-His tag

Price:
Size:
Number:

TGF beta 1 cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1173 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human transforming growth factor, beta 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
HindIII + XbaI (6kb + 1.22kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TGF beta 1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TGF beta 1 cDNA ORF Clone, Human, C-His tag: Alternative Names

CED cDNA ORF Clone, Human; DPD1 cDNA ORF Clone, Human; LAP cDNA ORF Clone, Human; TGF-beta 1 cDNA ORF Clone, Human; TGFB cDNA ORF Clone, Human; TGFbeta cDNA ORF Clone, Human

TGF beta 1 Background Information

TGF-beta 1 is a member of the transforming growth factor beta (TGF-beta) family. The transforming growth factor-beta family of polypeptides are involved in the regulation of cellular processes, including cell division, differentiation, motility, adhesion and death. TGF-beta 1 positively and negatively regulates many other growth factors. It inhibits the secretion and activity of many other cytokines including interferon-γ, tumor necrosis factor-alpha and various interleukins. It can also decrease the expression levels of cytokine receptors. Meanwhile, TGF-beta 1 also increases the expression of certain cytokines in T cells and promotes their proliferation, particularly if the cells are immature. TGF-beta 1 also inhibits proliferation and stimulates apoptosis of B cells, and plays a role in controlling the expression of antibody, transferrin and MHC class II proteins on immature and mature B cells. As for myeloid cells, TGF-beta 1can inhibit their proliferation and prevent their production of reactive oxygen and nitrogen intermediates. However, as with other cell types, TGF-beta 1 also has the opposite effect on cells of myeloid origin. TGF-beta 1 is a multifunctional protein that controls proliferation, differentiation and other functions in many cell types. It plays an important role in bone remodeling as it is a potent stimulator of osteoblastic bone formation, causing chemotaxis, proliferation and differentiation in committed osteoblasts. Once cells lose their sensitivity to TGF-beta1-mediated growth inhibition, autocrine TGF-beta signaling can promote tumorigenesis. Elevated levels of TGF-beta1 are often observed in advanced carcinomas, and have been correlated with increased tumor invasiveness and disease progression.
Full Name
transforming growth factor, beta 1
Research Areas
References
  • Ghadami M, et al. (2000) Genetic Mapping of the Camurati-Engelmann Disease Locus to Chromosome 19q13.1-q13.3. Am J Hum. Genet. 66(1):143-7.
  • Letterio J, et al. (1998) Regulation of immune responses by TGF-beta. Annu Rev Immunol. 16:137-61.
  • Vaughn SP, et al. (2000) Confirmation of the mapping of the Camurati-Englemann locus to 19q13. 2 and refinement to a 3.2-cM region. Genomics. 66(1):119-21.
  • Assoian R, et al. (1983) Transforming growth factor-beta in human platelets. Identification of a major storage site, purification, and characterization. J Biol Chem. 258(11):7155-60.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait