Commande rapide

Text Size:AAA

Humain TMED1 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

  • other Green fluorescent protein / GFP Gene Plasmid Map 5609
Fiche techniqueCommentairesProduits apparentésProtocoles
Humain TMED1 Informations sur les produits clonés de cDNA
Taille du ADNc:723 bp
Description du ADNc:Full length Clone DNA of Homo sapiens transmembrane emp24 protein transport domain conta with C terminal Flag tag.
Synonyme du gène:ST2L, Tp24, Il1rl1l, IL1RL1LG, TMED1
Site de restriction:KpnI + XbaI(6kb+0.72kb)
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
( We provide with TMED1 qPCR primers for gene expression analysis, HP102010 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

TMED1 belongs to the EMP24/GP25L family. It contains 1 GOLD domain and is widely expressed. TMED1 binds to its receptor IL1RL1 and results in the activation of DNA binding by nuclear factor NF-kappa-B or transcription from the IL8 promoter and most likely requires other proteins to elicit these activities. Dendritic cells from Peyer's patches (but not from spleen) express TMED1 in response to treatment with LPS. TMED1 may play a role in vesicular protein trafficking, mainly in the early secretory pathway. It may act as a cargo receptor at the lumenal side for incorporation of secretory cargo molecules into transport vesicles and may be involved in vesicle coat formation at the cytoplasmic side.

  • Colland F, et al. (2004) Functional Proteomics Mapping of a Human Signaling Pathway. Genome Res. 14(7):1324-32.
  • Gerhard DS, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.
  • Gerhard DS, et al. (2004) The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC) . Genome Res. 14(10B):2121-7.
  • Size / Price
    Catalogue : HG13302-CF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.