Commande rapide

Humain TNFAIP3 expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

  • Cynomolgus LOC101926731 Gene Plasmid Map 5628
Fiche techniqueCommentairesProduits apparentésProtocoles
Humain TNFAIP3 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_006290.2
Taille du ADNc:2415 bp
Description du ADNc:Full length Clone DNA of Homo sapiens tumor necrosis factor, alpha-induced protein 3 with N terminal HA tag.
Synonyme du gène:A20, OTUD7C, TNFA1P2, MGC104522, MGC138687, MGC138688, TNFAIP3
Espèces:Human
Vecteur:pCMV3-N-HA
Plasmid:pCMV3-HA-TNFAIP3
Site de restriction:KpnI + XbaI(6kb+2.42kb)
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with TNFAIP3 qPCR primers for gene expression analysis, HP101617 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Size / Price
Catalogue : HG12089-NY
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
DisponibilitéIn Stock
Ajouter au panierBulk Discount Requiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »