Commande rapide

Humain TNFRSF25/DR3/TNFRSF12 expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Humain TNFRSF25 Informations sur les produits clonés de cDNA
    Taille du ADNc:1254bp
    Description du ADNc:Full length Clone DNA of Homo sapiens tumor necrosis factor receptor superfamily, member 25 with N terminal HA tag.
    Synonyme du gène:DR3, TRAMP, WSL-1, LARD, WSL-LR, DDR3, TR3, APO-3
    Site de restriction:
    Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Description de la séquence:
    ( We provide with TNFRSF25 qPCR primers for gene expression analysis, HP101623 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name

    Tumor necrosis factor receptor superfamily, member 25 (TNFRSF25), also known as Death receptor 3 (DR3) or TNFRSF12 is a member of the TNF-receptor superfamily. This receptor is expressed preferentially in the tissues enriched in lymphocytes, and it may play a role in regulating lymphocyte homeostasis. TNFRSF25/DR3/TNFRSF12 has been shown to stimulate NF-kappa B activity and regulate cell apoptosis. The signal transduction of this receptor is mediated by various death domain containing adaptor proteins. Knockout studies in mice suggested the role of this gene in the removal of self-reactive T cells in the thymus. Multiple alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported, most of which are potentially secreted molecules. The alternative splicing of this TNFRSF25 encoding gene in B and T cells encounters a programmed change upon T-cell activation, which predominantly produces full-length, membrane bound isoforms, and is thought to be involved in controlling lymphocyte proliferation induced by T-cell activation.

  • Slebioda TJ, et al. (2011) Triggering of TNFRSF25 promotes CD8? T-cell responses and anti-tumor immunity. Eur J Immunol. 41(9): 606-11.
  • Fang L, et al. (2008) Essential role of TNF receptor superfamily 25 (TNFRSF25) in the development of allergic lung inflammation. J Exp Med. 205(5): 037-48.
  • Borysenko CW, et al. (2005) Comparative modeling of TNFRSF25 (DR3) predicts receptor destabilization by a mutation linked to rheumatoid arthritis. Biochem Biophys Res Commun. 328(3): 94-9.
  • Size / Price
    Catalogue : HG12095-NY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.