TPK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Price:
Size:
Number:

TPK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
732 bp
Description
Full length Clone DNA of Human thiamin pyrophosphokinase 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TPK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

HTPK1 cDNA ORF Clone, Human; PP20 cDNA ORF Clone, Human; THMD5 cDNA ORF Clone, Human

TPK1 Background Information

Thiamine pyrophosphokinase (TPK) produces thiamine pyrophosphate, a cofactor for a number of enzymes, including pyruvate dehydrogenase and 2-ketoglutarate dehydrogenase. Episodic encephalopathy type thiamine metabolism dysfunction (OMIM 614458) due to TPK1 mutations is a recently described rare disorder. The genomic variations in the fetal and maternal TPK1 gene could contribute to the variability of birth weight in normal humans.
Full Name
thiamin pyrophosphokinase 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait