C-MPL cDNA ORF Clone, Human, N-His tag

Price:
Size:
Number:

C-MPL cDNA ORF Clone, Human, N-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1908 bp
Description
Full length Clone DNA of Human myeloproliferative leukemia virus oncogene with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

C-MPL cDNA ORF Clone, Human, N-His tag: Alternative Names

C-MPL cDNA ORF Clone, Human; CD110 cDNA ORF Clone, Human; MPLV cDNA ORF Clone, Human; THCYT2 cDNA ORF Clone, Human; TPOR cDNA ORF Clone, Human

C-MPL Background Information

CD11, also known as c-MPL, is a 635 amino acid transmembrane domain, with two extracellular cytokine receptor domains and two intracellular cytokine receptor box motifs. It is expressed at a low level in a large number of cells of hematopoietic origin. C-MPL is homologous with members of the hematopoietic receptor superfamily. Presence of anti-sense oligodeoxynucleotides of c-mpl inhibited megakaryocyte colony formation. Thrombopoietin is the ligand for c-mpl. It was shown to be the major regulator of megakaryocytopoiesis and platelet formation. Defects in c-MPL are a cause of congenital amegakaryocytic thrombocytopeniawhich is a disease characterized by isolated thrombocytopenia and megakaryocytopenia with no physical anomalies. Defects in c-MPL also cause thrombocythemia type 2 and myelofibrosis with myeloid metaplasia.
Full Name
MPL proto-oncogene, thrombopoietin receptor
References
  • Vigon I., et al.,(1992), Molecular cloning and characterization of MPL, the human homolog of the v-mpl oncogene: identification of a member of the hematopoietic growth factor receptor superfamily. Proc. Natl. Acad. Sci. U.S.A. 89:5640-5644.
  • Mignotte V., et al., (1994), Structure and transcription of the human c-mpl gene (MPL).Genomics 20:5-12.
  • Gregory S.G., et al.,(2006), The DNA sequence and biological annotation of human chromosome 1.Nature 441:315-321.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait