After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain TPSB2 expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human TPSB2 Informations sur les produits clonés de cDNA
Taille du ADNc:828bp
Description du ADNc:Full length Clone DNA of Homo sapiens tryptase beta 2 with C terminal HA tag.
Synonyme du gène:TPS2, TPSB1, tryptaseC
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

Tryptases comprise a family of trypsin-like serine proteases, the peptidase family S1, and fall into two groups, α and β. β-tryptases appear to be the main isoenzymes expressed in mast cells, whereas α-tryptases predominate in basophils. Tryptase is unique in two respects: it is enzymatically active only as a heparin-stabilized tetramer, and it is resistant to all known endogenous proteinase inhibitors because of the unique arrangement of the active sites. Additionally, tryptase family genes have an intron immediately upstream of the initiator codon which separates the transcription initiation site from protein coding sequence, and this feature is characteristic of tryptases. β-tryptases existing in three isoforms (β1,β2,β3) are released in secretory granules, and have been implicated as mediators in the pathogenesis of asthma and other allergic and inflammatory disorders. It has been reported that β-tryptase selectively cleaves ASM-derived eotaxin and RANTES and abrogates their chemotactic activities.

  • Miller, J.S. et al., 1990, J. Clin. Invest. 86: 864-870.
  • Pereira, P.J. et al., 1998, Nature. 392: 306-311.
  • Pallaoro, al., 1999, J. Biol. Chem. 274: 3355-3362.
  • Pang, L. et al., 2006, J. Immunol. 176: 3788-3795.
  • Size / Price
    Catalogue : HG10505-CY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.