Commande rapide

Human Tie1 ORF mammalian expression plasmid, N-HA tag

Fiche techniqueCommentairesProduits apparentésProtocoles
Human TIE1 Informations sur les produits clonés de cDNA
Taille du ADNc:3417bp
Description du ADNc:Full length Clone DNA of Homo sapiens tyrosine kinase with immunoglobulin-like and EGF-like domains 1 with N terminal HA tag.
Synonyme du gène:TIE, JTK14
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

Tyrosine kinase with immunoglobulin-like and EGF-like domains 1 also known as Tie1 is an angiopoietin receptor and is an orphan receptor tyrosine kinase that is expressed almost exclusively in endothelial cells and that is required for normal embryonic vascular development. The receptor tyrosine kinase Tie1 is expressed primarily in vascular endothelial cells. The receptor has also been detected in epithelial tumours in breast, thyroid and gastric cancers and in tumour cell lines where it appears as a 45 kDa truncated receptor fragment. Tie1 promotes endothelial cell survival, but other studies have suggested that the Tie1 kinase has little to no activity. Embryos deficient in Tie1 failed to establish structural integrity of vascular endothelial cells, resulting in oedema and subsequently localized haemorrhage. Tie1 is significantly higher in human aortic endothelial cells than in human umbilical vein endothelial cells. Additionally, attachment of cells of monocytic lineage to endothelial cells is also enhanced by Tie1 expression. Collectively Tie1 has a proinflammatory property and may play a role in the endothelial inflammatory diseases such as atherosclerosis.

  • Chan B, et al. (2008) Receptor tyrosine kinase Tie-1 overexpression in endothelial cells upregulates adhesion molecules. Biochem Biophys Res Commun. 371(3): 475-9.
  • Sato TN, et al. (1995) Distinct roles of the receptor tyrosine kinases Tie-1 and Tie-2 in blood vessel formation. Nature. 376(6535): 70-4.
  • Rees KA, et al. (2007) The receptor tyrosine kinase Tie1 is expressed and activated in epithelial tumour cell lines. Int J Oncol. 31(4): 893-7.
  • Kontos CD, et al. (2002) The endothelial receptor tyrosine kinase Tie1 activates phosphatidylinositol 3-kinase and Akt to inhibit apoptosis. Mol Cell Biol. 22(6): 1704-13.
  • Size / Price
    Catalogue : HG10509-NY
    Prix catalogue :   (Save )
    Prix :      [How to order]
     Instructions d’expédition
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.