E1 Ubiquitin Activating Enzyme / UBA1 cDNA ORF Clone, Human, C-His tag

1/1
Price:
Size:
Number:

E1 Ubiquitin Activating Enzyme / UBA1 cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3222 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human ubiquitin like modifier activating enzyme 1
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + NotI(6kb+3.22kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' ) BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

E1 Ubiquitin Activating Enzyme / UBA1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

E1 Ubiquitin Activating Enzyme / UBA1 cDNA ORF Clone, Human, C-His tag: Validated Images

E1 Ubiquitin Activating Enzyme / UBA1 cDNA ORF Clone, Human, C-His tag: Alternative Names

A1S9 cDNA ORF Clone, Human; A1S9T cDNA ORF Clone, Human; A1ST cDNA ORF Clone, Human; AMCX1 cDNA ORF Clone, Human; CFAP124 cDNA ORF Clone, Human; CTD-2522E6.1 cDNA ORF Clone, Human; GXP1 cDNA ORF Clone, Human; POC20 cDNA ORF Clone, Human; SMAX2 cDNA ORF Clone, Human; UBA1A cDNA ORF Clone, Human; UBE1 cDNA ORF Clone, Human; UBE1X cDNA ORF Clone, Human

E1 Ubiquitin Activating Enzyme / UBA1 Background Information

UBE1, also known as UBA1, belongs to the ubiquitin-activating E1 family. UBE1 gene complements an X-linked mouse temperature-sensitive defect in DNA synthesis, and thus may function in DNA repair. It is part of a gene cluster on chromosome Xp11.23. UBE1 catalyzes the first step in ubiquitin conjugation to mark cellular proteins for degradation. It also catalyzes the first step in ubiquitin conjugation to mark cellular proteins for degradation by first adenylating its C-terminal glycine residue with ATP, and thereafter linking this residue to the side chain of a cysteine residue in E1, yielding an ubiquitin-E1 thioester and free AMP. Defects in UBA1 can cause spinal muscular atrophy X-linked type 2 (SMAX2), also known as X-linked lethal infantile spinal muscular atrophy, distal X-linked arthrogryposis multiplex congenita or X-linked arthrogryposis type 1 (AMCX1). Spinal muscular atrophy refers to a group of neuromuscular disorders characterized by degeneration of the anterior horn cells of the spinal cord, leading to symmetrical muscle weakness and atrophy. SMAX2 is a lethal infantile form presenting with hypotonia, areflexia, and multiple congenital contractures.
Full Name
ubiquitin-like modifier activating enzyme 1
References
  • Jin J, et al. (2007) Dual E1 activation systems for ubiquitin differentially regulate E2 enzyme charging. Nature. 447(7148):1135-8.
  • Xia T, et al. (2007) Chaperone-dependent E3 ligase CHIP ubiquitinates and mediates proteasomal degradation of soluble guanylyl cyclase. Am J Physiol Heart Circ Physiol. 293(5):H3080-7.
  • Pridgeon JW, et al. (2009) Proteomic analysis reveals Hrs UIM-mediated ubiquitin signaling in multiple cellular processes. FEBS J. 276(1):118-31.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait