Commande rapide

Humain E6AP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human UBE3A Informations sur les produits clonés de cDNA
Taille du ADNc:2559bp
Description du ADNc:Full length Clone DNA of Homo sapiens ubiquitin protein ligase E3A, transcript variant 1 with C terminal His tag.
Synonyme du gène:AS, ANCR, E6-AP, HPVE6A, EPVE6AP, FLJ26981, UBE3A
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humain E6AP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
Humain E6AP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG11130-ACGCHF390
Humain E6AP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG11130-ACRCHF390
Humain E6AP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG11130-ANGCHF390
Humain E6AP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG11130-ANRCHF390
Humain E6AP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11130-CFCHF350
Humain E6AP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG11130-CHCHF350
Humain E6AP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG11130-CMCHF350
Humain E6AP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG11130-CYCHF350
Humain E6AP transcript variant 1 Gène ADNc clone le vecteur de clonageHG11130-MCHF90
Humain E6AP transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG11130-M-NCHF350
Humain E6AP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG11130-NFCHF350
Humain E6AP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG11130-NHCHF350
Humain E6AP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG11130-NMCHF350
Humain E6AP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG11130-NYCHF350
Humain E6AP transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG11130-UTCHF350
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG11130-CH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.