Commande rapide

Human UCHL3 ORF mammalian expression plasmid, C-Flag tag

Fiche techniqueCommentairesProduits apparentésProtocoles
Human UCHL3 Informations sur les produits clonés de cDNA
Taille du ADNc:693bp
Description du ADNc:Full length Clone DNA of Homo sapiens ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) with C terminal Flag tag.
Synonyme du gène:UCH-L3, UCHL3
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Ubiquitin carboxyl-terminal hydrolase isozyme L3, also known as UCH-L3, Ubiquitin thioesterase L3 and UCHL3, is a ubiquitin-protein hydrolase which belongs to the peptidase C12 family. It is involved both in the processing of ubiquitin precursors and of ubiquitinated proteins. This enzyme is a thiol protease that recognizes and hydrolyzes a peptide bond at the C-terminal glycine of either ubiquitin or NEDD8. UCHL3 is highly expressed in heart, skeletal muscle, and testis. UCHL1 and UCHL3 are two of the deubiquitinating enzymes expressed in the brain. These phenotypes indicate the importance of UCHL1 and UCHL3 in the regulation of the central nervous system. UCHL3 functions as a de-ubiquitinating enzyme where lack of its hydrolase activity may result in the prominent accumulation of ubiquitinated proteins and subsequent induction of stress responses in skeletal muscle. UCHL3 has also been identified as a tumor-specific antigen in colon cancer.

  • Wood,M.A. et al., 2005, Hippocampus  15 (5):610-21.
  • Kwon,J. et al., 2006, Exp Anim  55 (1):35-43.
  • Setsuie,R. et al., 2009, Neurochem Int  54 (5-6):314-21.
  • Setsuie,R. et al., 2010, Neurochem Int  56 (8):911-8.
  • Size / Price
    Catalogue : HG11634-CF
    Prix catalogue :   (Save )
    Prix :      [How to order]
    Disponibilité2-3 weeks
     Instructions d’expédition
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.