Commande rapide

Humain USH1C/Harmonin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human USH1C Informations sur les produits clonés de cDNA
Taille du ADNc:1659bp
Description du ADNc:Full length Clone DNA of Homo sapiens Usher syndrome 1C (autosomal recessive, severe), transcript variant 1 with C terminal Myc tag.
Synonyme du gène:PDZ73, AIE-75, DFNB18, PDZ-45, PDZ-73, NY-CO-37, NY-CO-38, ush1cpst, PDZ-73/NY-CO-38
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humain USH1C/Harmonin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur on other vectors
Humain USH1C/Harmonin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10613-ACGCHF290
Humain USH1C/Harmonin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10613-ACRCHF290
Humain USH1C/Harmonin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10613-ANGCHF290
Humain USH1C/Harmonin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10613-ANRCHF290
Humain USH1C/Harmonin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10613-CFCHF260
Humain USH1C/Harmonin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10613-CHCHF260
Humain USH1C/Harmonin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10613-CMCHF260
Humain USH1C/Harmonin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10613-CYCHF260
Humain USH1C/Harmonin transcript variant 1 Gène ADNc clone le vecteur de clonageHG10613-MCHF90
Humain USH1C/Harmonin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10613-M-FCHF260
Humain USH1C/Harmonin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10613-NFCHF260
Humain USH1C/Harmonin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10613-NHCHF260
Humain USH1C/Harmonin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10613-NMCHF260
Humain USH1C/Harmonin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10613-NYCHF260
Humain USH1C/Harmonin transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG10613-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Harmonin, also known as Antigen NY-CO-38 / NY-CO-37, Autoimmune enteropathy-related antigen AIE-75, Protein PDZ-73, Renal carcinoma antigen NY-REN-3, Usher syndrome type-1C protein and USH1C, is a protein which is expressed in small intestine, colon, kidney, eye and weakly in pancreas. USH1C is expressed also in vestibule of the inner ear. USH1C contains 3 PDZ (DHR) domains. USH1C may be involved in protein-protein interaction. Defects in USH1C are the cause of Usher syndrome type 1C (USH1C), also known as Usher syndrome type I Acadian variety. USH is a genetically heterogeneous condition characterized by the association of retinitis pigmentosa and sensorineural deafness. Age at onset and differences in auditory and vestibular function distinguish Usher syndrome type 1 (USH1), Usher syndrome type 2 (USH2) and Usher syndrome type 3 (USH3). Defects in USH1C are also the cause of deafness autosomal recessive type 18 (DFNB18) which is a form of sensorineural hearing loss. Sensorineural deafness results from damage to the neural receptors of the inner ear, the nerve pathways to the brain, or the area of the brain that receives sound information.

  • Verpy, E. et al., 2000, Nat Genet. 26 (1):51-5.
  • Weil D., et al., 2003, Hum. Mol. Genet. 12:463-471.
  • Reiners,J. et al., 2005, Hum Mol Genet. 14 (24):3933-43.
  • Yan,D. et al., 2006, Mol Biol. 357 (3):755-64.
  • Size / Price
    Catalogue : HG10613-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.