Commande rapide

Humain Uteroglobin/SCGB1A1 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human SCGB1A1 Informations sur les produits clonés de cDNA
Taille du ADNc:276bp
Description du ADNc:Full length Clone DNA of Homo sapiens secretoglobin, family 1A, member 1 (uteroglobin) with N terminal Myc tag.
Synonyme du gène:UGB, CC10, CC16, CCSP, SCGB1A1
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

Uteroglobin (UG), also known as Secretoglobin 1A member 1 (SCGB1A1), Blastokinin, Clara cell secretor protein (CCSP) or Clara cell-specific 10-kDa protein (CC10), is the founding member of the secretoglobin family of small, secreted, disulfide-bridged dimeric proteins found only in mammals. This protein is mainly expressed in lung, with anti-inflammatory/immunomodulatory properties. Previous in vitro studies demonstrated that CCAAT/enhancer-binding proteins (C/EBPs) are the major transcription factors for the regulation of SCGB1A1 gene expression, whereas FOXA1 had a minimum effect on the transcription. Uteroglobin is a multifunctional protein with antiinflammatory/immunomodulatory properties. Uteroglobin inhibits soluble phospholipase A(2) activity and binds and perhaps sequesters hydrophobic ligands such as progesterone, retinols, polychlorinated biphenyls, phospholipids, and prostaglandins. In addition to its antiinflammatory activities, Uteroglobin manifests antichemotactic, antiallergic, antitumorigenic, and embryonic growth-stimulatory activities. The tissue-specific expression of the Uteroglobin gene is regulated by several steroid hormones, although a nonsteroid hormone, prolactin, further augments its expression in the uterus. Based on its anti-inflammatory and antiallergic properties, Uteroglobin is a potential drug target. The mechanism of Uteroglobin action is likely to be even more complex as it also functions via a putative receptor-mediated pathway.

  • Mukherjee AB, et al. (1999). Uteroglobin: a novel cytokine? Cell Mol Life Sci. 55(5): 771-87.
  • Klug J, et al. (2000). Uteroglobin/Clara cell 10-kDa family of proteins: nomenclature committee report. Ann. N. Y. Acad. Sci. 923: 348-54.
  • Laukaitis CM, et al. (2005). Evolution of the secretoglobins: a genomic and proteomic view. Biological Journal of the Linnean Society. 84 (3): 493-501.
  • Mukherjee AB, et al. (2007). Uteroglobin: a steroid-inducible immunomodulatory protein that founded the Secretoglobin superfamily. Endocr Rev. 28(7): 707-25.
  • Kido T, et al. (2011). FOXA1 plays a role in regulating secretoglobin 1a1 expression in the absence of CCAAT/enhancer binding protein activities in lung in vivo. Am J Physiol Lung Cell Mol Physiol. 300(3): L441-52.
  • Size / Price
    Catalogue : HG10808-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.