VAMP2 cDNA ORF Clone, Human, C-His tag

Price:
Size:
Number:

VAMP2 cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
351 bp
Description
Full length Clone DNA of Human vesicle-associated membrane protein 2 (synaptobrevin 2) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

VAMP2 cDNA ORF Clone, Human, C-His tag: Alternative Names

SYB2 cDNA ORF Clone, Human; VAMP-2 cDNA ORF Clone, Human

VAMP2 Background Information

Vesicle-associated membrane protein 2 (VAMP2), a member of soluble N-ethylmaleimide sensitive factor attachment protein receptor (SNAREs) is required for membrane fusion. The transmembrane domains (TMDs) of VAMP2 plays a critical role in membrane fusion and that the structural mobility provided by the central small amino acids is crucial for exocytosis by influencing the molecular re-arrangements of the lipid membrane that are necessary for fusion pore opening and expansion. Moreover, VAMP2 is the main vesicle associated membrane protein (VAMP) isoform functionally involved in antibody secretion.
Full Name
vesicle-associated membrane protein 2 (synaptobrevin 2)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait