Commande rapide

Humain DUSP3/VHR expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human DUSP3 Informations sur les produits clonés de cDNA
Taille du ADNc:558bp
Description du ADNc:Full length Clone DNA of Homo sapiens dual specificity phosphatase 3 with N terminal His tag.
Synonyme du gène:DUSP3, VHR
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

Vaccinia H1-related phosphatase (VHR) is classified as a dual-specificity phosphatase (DUSP), and the other name is dual-specificity phosphatase 3 (DUSP3). DUSPs are a heterogeneous group of protein phosphatases that can dephosphorylate both phosphotyrosine and phosphoserine/phosphothreonine residues within the one substrate. Unlike typical DUSPs, VHR lacks mitogen-activated protein kinase (MAPK)-binding domain, and shows poor activity against MAPKs. VHR often act on bisphosphorylated protein substrates, it displays a strong preference for dephosphorylating phosphotyrosine residues over phosphothreonine residues. VHR has been identified as a novel regulator of extracellular regulated kinases (ERKs). VHR is responsible for the rapid inactivation of ERK following stimulation and for its repression in quiescent cells. VHR is a negative regulator of the Erk and Jnk pathways in T cells and, therefore, may play a role in aspects of T lymphocyte physiology that depend on these kinases.

  • Todd J.L, et al. (1999) Extracellular regulated kinases (ERK) 1 and ERK2 are authentic substrates for the dual-specificity protein-tyrosine phosphatase VHR. A novel role in down-regulating the ERK pathway. J. Biol. Chem. 274: 13271-80.
  • Alonso A, et al. (2001) Inhibitory role for dual specificity phosphatase VHR in T cell antigen receptor and CD28-induced Erk and Jnk activation. J Biol Chem. 276(7): 4766-71.
  • Schumacher MA, et al. (2002) Structural basis for the recognition of a bisphosphorylated MAP kinase peptide by human VHR protein Phosphatase. Biochemistry. 41(9): 3009-17.
  • Patterson KI, et al. (2009) Dual-specificity phosphatases: critical regulators with diverse cellular targets. Biochem J. 2009 Mar 15;418(3): 475-89.
  • Size / Price
    Catalogue : HG10114-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.