VIP cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

VIP cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
510 bp
Description
Full length Clone DNA of Human vasoactive intestinal peptide with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

VIP cDNA ORF Clone, Human, N-Myc tag: Alternative Names

PHM27 cDNA ORF Clone, Human

VIP Background Information

VIP, or vasoactive intestinal peptide, is a neuropeptide of 28 amino acid residues that belongs to a glucagon/secretin superfamily, and it exerts its actions through three G-protein-coupled receptors (PAC1, VPAC1, and VPAC2). VIP is synthesized by trophoblast cells; it regulates trophoblast cell function and interaction with the major immune cell populations present in the pregnant uterus.
Full Name
vasoactive intestinal peptide
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait