WARS cDNA ORF Clone, Human, C-DDK (Flag®) tag

Price:
Size:
Number:

WARS cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1416 bp
Description
Full length Clone DNA of Human tryptophanyl-tRNA synthetase with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

WARS cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

GAMMA-2 cDNA ORF Clone, Human; IFI53 cDNA ORF Clone, Human; IFP53 cDNA ORF Clone, Human

WARS Background Information

WARS, also known as TrpRS, is an aminoacyl-tRNA synthetase which belongs to the class-I aminoacyl-tRNA synthetase family. There are two forms of tryptophanyl-tRNA synthetase: a cytoplasmic form, named WARS, and a mitochondrial form, named WARS2. They catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. WARS catalyzes the aminoacylation of tRNA(trp) with tryptophan and is induced by interferon.
Full Name
tryptophanyl-tRNA synthetase
References
  • Buwitt U. et al., 1992, EMBO J. 11 (2): 489-96.
  • Fleckner J. et al., 1992, Proc Natl Acad Sci. 88 (24): 11520-4.
  • Ewalt KL. et al., 2002, Biochemistry. 41 (45): 13344-9.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait