Commande rapide

Humain Wnt4 expression plasmide de Gène l'ADNc ORF clone

  • Human WNT-4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Fiche techniqueCommentairesProduits apparentésProtocoles
Humain WNT4 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_030761.4
Taille du ADNc:1056bp
Description du ADNc:Full length Clone DNA of Homo sapiens wingless-type MMTV integration site family, member 4.
Synonyme du gène:WNT-4, SERKAL, WNT4
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:pCMV3-WNT4
Site de restriction:KpnI + XbaI (6.1kb + 1.06kb)
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with Wnt4 qPCR primers for gene expression analysis, HP100640 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Humain WNT4 Gene Plasmid Map
Human WNT-4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalogue : HG10674-UT
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité
Ajouter au panierBulk Discount Requiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »