Commande rapide

Text Size:AAA

Humain ZAP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human ZAP70 Informations sur les produits clonés de cDNA
Taille du ADNc:1860bp
Description du ADNc:Full length Clone DNA of Homo sapiens zeta-chain (TCR) associated protein kinase 70kDa, transcript variant 1 with N terminal His tag.
Synonyme du gène:ZAP70, SRK, STD, TZK, ZAP-70, FLJ17670, FLJ17679
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humain ZAP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
Humain ZAP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10116-ACGCHF290
Humain ZAP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10116-ACRCHF290
Humain ZAP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10116-ANGCHF290
Humain ZAP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10116-ANRCHF290
Humain ZAP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10116-CFCHF260
Humain ZAP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10116-CHCHF260
Humain ZAP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10116-CMCHF260
Humain ZAP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10116-CYCHF260
Humain ZAP transcript variant 1 Gène ADNc clone le vecteur de clonageHG10116-MCHF90
Humain ZAP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10116-NFCHF260
Humain ZAP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10116-NHCHF260
Humain ZAP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10116-NMCHF260
Humain ZAP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10116-NYCHF260
Humain ZAP transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG10116-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG10116-NH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.