Commande rapide

Text Size:AAA

Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human EIF2A Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_032025.3
Taille du ADNc:1758bp
Description du ADNc:Full length Clone DNA of Homo sapiens eukaryotic translation initiation factor 2A, 65kDa (EIF2A) with N terminal His tag.
Synonyme du gène:EIF2A, CDA02, EIF-2A, MST089, MSTP004, MSTP089
Espèces:Human
Vecteur:pCMV3-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10112-ACGCHF290
Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10112-ACRCHF290
Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10112-ANGCHF290
Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10112-ANRCHF290
Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10112-CFCHF260
Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10112-CHCHF260
Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10112-CMCHF260
Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10112-CYCHF260
Humain eIF2A/eIF2 alpha Gène ADNc clone le vecteur de clonageHG10112-MCHF90
Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10112-M-FCHF260
Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10112-NFCHF260
Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10112-NHCHF260
Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10112-NMCHF260
Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10112-NYCHF260
Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF cloneHG10112-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG10112-NH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »