Commande rapide

Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human EIF2A Informations sur les produits clonés de cDNA
Taille du ADNc:1758bp
Description du ADNc:Full length Clone DNA of Homo sapiens eukaryotic translation initiation factor 2A, 65kDa (EIF2A) with N terminal His tag.
Synonyme du gène:EIF2A, CDA02, EIF-2A, MST089, MSTP004, MSTP089
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10112-ACGCHF290
Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10112-ACRCHF290
Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10112-ANGCHF290
Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10112-ANRCHF290
Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10112-CFCHF260
Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10112-CHCHF260
Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10112-CMCHF260
Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10112-CYCHF260
Humain eIF2A/eIF2 alpha Gène ADNc clone le vecteur de clonageHG10112-MCHF90
Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10112-M-FCHF260
Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10112-NFCHF260
Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10112-NHCHF260
Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10112-NMCHF260
Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10112-NYCHF260
Humain eIF2A/eIF2 alpha expression plasmide de Gène l'ADNc ORF cloneHG10112-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG10112-NH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.