Commande rapide

Text Size:AAA

Humain IL-8/Interleukin-8/CXCL8 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human CXCL8 Informations sur les produits clonés de cDNA
Taille du ADNc:300bp
Description du ADNc:Full length Clone DNA of Homo sapiens interleukin 8 with N terminal His tag.
Synonyme du gène:CXCL8, GCP-1, GCP1, LECT, LUCT, LYNAP, MDNCF, MONAP, NAF, NAP-1, NAP1
Site de restriction:KpnI + XbaI (6kb + 0.33kb)
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human CXCL8 Gene Plasmid Map
Human interleukin 8 ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

Interleukin 8 (IL-8), also known as CXCL8, which is a chemokine with a defining CXC amino acid motif that was initially characterized for its leukocyte chemotactic activity, is now known to possess tumorigenic and proangiogenic properties as well. This chemokine is secreted by a variety of cell types including monocyte/macrophages, T cells, neutrophils, fibroblasts, endothelial cells, and various tumor cell lines in response to inflammatory stimuli (IL1, TNF, LPS, etc). In human gliomas, IL-8 is expressed and secreted at high levels both in vitro and in vivo, and recent experiments suggest it is critical to glial tumor neovascularity and progression. Levels of IL-8 correlate with histologic grade in glial neoplasms, and the most malignant form, glioblastoma, shows the highest expression in pseudopalisading cells around necrosis, suggesting that hypoxia/anoxia may stimulate expression. Interleukin (IL)-8/CXCL8 is a potent neutrophil chemotactic factor. Accumulating evidence has demonstrated that various types of cells can produce a large amount of IL-8/CXCL8 in response to a wide variety of stimuli, including proinflammatory cytokines, microbes and their products, and environmental changes such as hypoxia, reperfusion, and hyperoxia. Numerous observations have established IL-8/CXCL8 as a key mediator in neutrophil-mediated acute inflammation due to its potent actions on neutrophils. However, several lines of evidence indicate that IL-8/CXCL8 has a wide range of actions on various types of cells, including lymphocytes, monocytes, endothelial cells, and fibroblasts, besides neutrophils. The discovery of these biological functions suggests that IL-8/CXCL8 has crucial roles in various pathological conditions such as chronic inflammation and cancer. IL-8 has been associated with tumor angiogenesis, metastasis, and poor prognosis in breast cancer. IL-8 may present a novel therapeutic target for estrogen driven breast carcinogenesis and tumor progression.

  • Mukaida N. (2003) Pathophysiological roles of interleukin-8/CXCL8 in pulmonary diseases. Am J Physiol Lung Cell Mol Physiol. 284(4): L566-77.
  • Brat DJ, et al. (2005) The role of interleukin-8 and its receptors in gliomagenesis and tumoral angiogenesis. Neuro Oncol. 7(2): 122-33.
  • Bendrik C, et al. (2009) Estradiol increases IL-8 secretion of normal human breast tissue and breast cancer in vivo. J Immunol. 182(1): 371-8.
  • Size / Price
    Catalogue : HG10098-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    Contact Us
    • Human interleukin 8 ORF mammalian expression plasmid, N-His tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.