After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain NRG1/Neuregulin 1 transcript variant HRG-beta2 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human NRG1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_013957.3
Taille du ADNc:1914bp
Description du ADNc:Full length Clone DNA of Homo sapiens neuregulin 1 transcript variant HRG-beta2.
Synonyme du gène:GGF, HGL, HRG, NDF, ARIA, GGF2, HRG1, HRGA, SMDF
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Humain NRG1/Neuregulin 1 transcript variant HRG-beta2 expression plasmide de Gène l'ADNc ORF clone on other vectors
Humain NRG1/Neuregulin 1 transcript variant HRG-beta2 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10658-ACGCHF290
Humain NRG1/Neuregulin 1 transcript variant HRG-beta2 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10658-ACRCHF290
Humain NRG1/Neuregulin 1 transcript variant HRG-beta2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10658-CFCHF260
Humain NRG1/Neuregulin 1 transcript variant HRG-beta2 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10658-CHCHF260
Humain NRG1/Neuregulin 1 transcript variant HRG-beta2 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10658-CMCHF260
Humain NRG1/Neuregulin 1 transcript variant HRG-beta2 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10658-CYCHF260
Humain NRG1/Neuregulin 1 transcript variant HRG-beta2 Gène ADNc clone le vecteur de clonageHG10658-MCHF90
Humain NRG1/Neuregulin 1 transcript variant HRG-beta2 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10658-NFCHF260
Humain NRG1/Neuregulin 1 transcript variant HRG-beta2 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10658-NHCHF260
Humain NRG1/Neuregulin 1 transcript variant HRG-beta2 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10658-NMCHF260
Humain NRG1/Neuregulin 1 transcript variant HRG-beta2 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10658-NYCHF260
Humain NRG1/Neuregulin 1 transcript variant HRG-beta2 expression plasmide de Gène l'ADNc ORF cloneHG10658-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

Neuregulin 1 or NRG1 is one of four proteins in the neuregulin family that act on the EGFR family of receptors. This growth factor was originally identified as a 44-kD glycoprotein that interacts with the NEU / ERBB2 receptor tyrosine kinase to increase its phosphorylation on tyrosine residues. NRG1 is a trophic factor that has been implicated in neural development, neurotransmission, and synaptic plasticity. NRG1 has multiple isoforms that are generated by usage of different promoters and alternative splicing of a single gene. Neuregulin 1 (NRG1) is essential for the development and function of multiple organ systems, and its dysregulation has been linked to diseases such as cancer and schizophrenia. NRG1 is a schizophrenia candidate gene and plays an important role in brain development and neural function. Schizophrenia is a complex disorder, with etiology likely due to epistasis. 

Références
  • Nicodemus KK, et al. (2010) Biological validation of increased schizophrenia risk with NRG1, ERBB4, and AKT1 epistasis via functional neuroimaging in healthy controls. Arch Gen Psychiatry. 67 (10): 991-1001.
  • Tan W, et al. (2007) Molecular cloning of a brain-specific, developmentally regulated neuregulin 1 (NRG1) isoform and identification of a functional promoter variant associated with schizophrenia. J Biol Chem. 282 (33): 24343-51.
  • Holmes WE, et al. (1992) Identification of heregulin, a specific activator of p185erbB2. Science. 256 (5060): 1205-10.
  • Size / Price
    Catalogue : HG10658-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »