Commande rapide

Humain respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
RSV RSV-G Informations sur les produits clonés de cDNA
Taille du ADNc:897bp
Description du ADNc:Full length Clone DNA of Human RSV (subtype A, strain A2) glycoprotein G / RSV-G with N terminal His tag.
Synonyme du gène:G, HRSVgp07
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with P03423.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humain respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-His Marqueur on other vectors
Humain respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40038-ACGCHF390
Humain respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP MarqueurVG40038-ACRCHF390
Humain respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized), C-Flag MarqueurVG40038-CFCHF350
Humain respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-His MarqueurVG40038-CHCHF350
Humain respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-Myc MarqueurVG40038-CMCHF350
Humain respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-HA MarqueurVG40038-CYCHF350
Humain respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized)VG40038-GCHF110
Humain respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-Flag MarqueurVG40038-NFCHF350
Humain respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-His MarqueurVG40038-NHCHF350
Humain respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40038-NMCHF350
Humain respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-HA MarqueurVG40038-NYCHF350
Humain respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized)VG40038-UTCHF350
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Human respiratory syncytial virus (HRSV) is the most common etiological agent of acute lower respiratory tract disease in infants and can cause repeated infections throughout life. It is classified within the genus pneumovirus of the family paramyxoviridae. Like other members of the family, HRSV has two major surface glycoproteins (G and F) that play important roles in the initial stages of the infectious cycle. HRSV G protein is a type II glycoprotein of 289-299 amino acids (depending on the virus strain) with a signal/anchor hydrophobic domain and is extensively modified by the addition of both N-and O-linked oligosaccharides to achieve the mature form of 80-90 kDa. The C-terminal ectodomain of the G protein has a central region and four cysteines which are conserved in all HRSV isolates and have been proposed as the putative receptor binding site. The G protein mediates attachment of the virus to the host cell membrane by interacting with heparan sulfate, initiating the infection. As similar to mucins in amino acid compositions, the RSV G protein can interact with host CX3CR1, the receptor for the CX3C chemokine fractalkine, and thus modulates the immune response and facilitate infection. Secreted glycoprotein G helps RSV escape antibody-dependent restriction of replication by acting as an antigen decoy and by modulating the activity of leukocytes bearing Fcgamma receptors. Unlike the other paramyxovirus attachment proteins, HRSV-G lacks both neuraminidase and hemagglutinating activities.

  • Martin-Gallardo A. et al., 1993, J Gen Virol. 74 : 453-8.
  • Jose AM. et al.,1997, J Gen Virol. 78: 2411-8.
  • Feldman SA. et al., 1999, J Virol. 73: 6610-7.
  • García-Beato R. et al., 2000, J Gen Virol. 81: 919-27.
  • Zlateva KT. et al., 2004, J Virol. 78: 4675-83.
  • Trento A. et al., 2006, J Virol. 80: 975-84.
  • Size / Price
    Catalogue : VG40038-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.